| Products/Services Used | Details | Operation |
|---|---|---|
| PCR Cloning and Subcloning> | ... All RNA constructs contained a hairpin structure (GGCCCCCCCCGAAAGGGGGGGG) followed by 32, 63, 92 or 118 adenines (Supplementary Table S1). The DNA vector containing 63, 92 or 118 adenines were obtained from gene-synthesis (GenScript USA Inc.). ... | Get A Quote |
The exosome plays an important role in RNA degradation and processing. In archaea, three Rrp41:Rrp42 heterodimers assemble into a barrel like structure that contains a narrow RNA entrance pore and a lumen that contains three active sites. Here, we demonstrate that this quaternary structure of the exosome is important for efficient RNA degradation. We find that the entrance pore of the barrel is required for nM substrate affinity. This strong interaction is crucial for processive substrate degradation and prevents premature release of the RNA from the enzyme. Using methyl TROSY NMR techniques, we establish that the 3' end of the substrate remains highly flexible inside the lumen. As a result, the RNA jumps betwe... More