| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | ... The DC transcription vector Stem-DC-XL-CDV was made (GenScript, Piscataway, NJ, USA) by inserting DNA between Pst1 and BamH1 sites of pUC57 that corresponded to a T3 promoter followed by a hairpin (GGGCCCGACCCGGTGACGGGTCGGGCCC) (ΔG = −32.40 kcal ... | Get A Quote |
Cadicivirus (CDV) is unique amongst picornaviruses in having a dicistronic genome with internal ribosomal entry sites (IRESs) preceding both open reading frames. Here, we investigated initiation on the 5'-terminal IRES. We report that the 982-nt long 5'UTR comprises 12 domains (d1-d12), five of which (d8-d12, nts 341-950) constitute a divergent Type I IRES. It comprises central elements (the apex of d10, d11 and the following polypyrimidine tract) that are homologous to corresponding elements in canonical Type 1 IRESs, and non-canonical flanking domains (d8, d9 and d12). In vitro reconstitution revealed that as with canonical Type I IRESs, 48S complex formation requires eukaryotic initiation factors (eIFs) 1, 1... More