| Products/Services Used | Details | Operation | 
|---|---|---|
| DNA Sequencing> | ... reserve (GGATTCCAGGAGCTTCCATTC) primer. All PCR products were checked 129 by electrophoresis and sequenced by Genscript (Nanjing, China) to confirm their 130 identities. For further experiments, two independent transgenic lines each in the Col-0 131 ... | Get A Quote | 
Arsenic (As) contamination in soil can lead to elevated transfer of As to the food chain. One potential mitigation strategy is to genetically engineer plants to enable them to transform inorganic As to methylated and volatile As species. In this study, we genetically engineered two ecotypes of Arabidopsis thaliana with the arsenite (As(III)) S-adenosylmethyltransferase (arsM) gene from the eukaryotic alga Chlamydomonas reinhardtii. The transgenic A. thaliana plants gained a strong ability to methylate As, converting most of the inorganic As into dimethylarsenate [DMA(V)] in the shoots. Small amounts of volatile As were detected from the transgenic plants. However, the transgenic plants became more sensitive to ... More
