| Products/Services Used | Details | Operation |
|---|---|---|
| Bacterial Protein Expression System> | ... pET29a-asnB was transformed into Es. coli DH5α to obtain a large amount of recombinant plasmid. asnB was sequenced with universal primers (T7F: TAATACGACTCACTATAGGG; T7R: TGCTAGTTATTGCTCAGCGG) from Genscript Technologies Co. (Nanjing, China). ... | Get A Quote |
This study reports the identification of a novel bacterial type II l-asparaginase, abASNase2, from Aquabacterium sp. A7-Y. The enzyme contains 319 amino acids and shared 35% identity with Escherichia coli type II l-asparaginase (EcAII), a commercial enzyme trademarked Elspar® that is widely used for medical applications. abASNase2 had high specific activity (458.9U/mg) toward l-asparagine, very low activity toward l-glutamine and d-glutamine and no activity toward d-asparagine. The optimal enzymatic activity conditions for abASNase2 were found to be 50mM Tris-HCl buffer (pH 9.0) at 60°C. It was very stable in the pH range of 7.0-11.0 and exhibited up to 80% relative activity after 2h below 40°C. The Km and k... More