| Products/Services Used | Details | Operation |
|---|---|---|
| Molecular Biology Reagents> | ... 120 ng of genomic DNA was incubated in a total reaction mixture of 20 μL containing both the forward primer 5′ CTATCCAGAAAACACGGTGGGCC 3′ and the reverse primer 5′ TCTATATTCAATCAAATGCTACAAAACC 3′ (~10 picomoles) (GenScript Corp., USA), 200 μM ... | Get A Quote |
Superoxide dismutase is an antioxidant enzyme that is involved in defence mechanisms against oxidative stress. Cu/Zn SOD is a variant that is located in exon3/intron3 boundary. The aim of the present study was to investigate whether the Cu/Zn SOD (+35A/C) gene polymorphism is associated with the susceptibility to type 2 diabetes mellitus among south Indian population. The study included patients with type 2 diabetes mellitus (n = 100) and healthy controls (n = 75). DNA was isolated from the blood and genotyping of Cu/Zn SOD gene polymorphism was done by polymerase chain reaction based restriction fragment length polymorphism method. Occurrence of different genotypes and normal (A) and mutant (C) allele frequenc... More