Human B2M-R validation primer
Reverse primer (Desalt grade) used for the validation of base editing of human B2M gene. [Reference] Gaudelli, N. W. et al Nature Biotechnology 2020; 38, 892–901
| ￥30 | |
| KIOK23 | |
|
|
|
|
|
|
|
|
|
| ￥30 | |
| KIOK23 | |
|
|
|
|
|
|
|
|
|
| Description | Reverse primer (Desalt grade) used for the validation of base editing of human B2M gene. [Reference] Gaudelli, N. W. et al Nature Biotechnology 2020; 38, 892–901 | ||||||
| Sequence |
GCAGGGAAACTACTGGTTCAGA |
||||||
| Storage Condition | Stable for at least 24 months at -20°C. Avoid repeated freeze-thaw cycles. | ||||||
| Quality Specifications |
|
