pGen2.1

Description GenScript vector pGen2.1 is a Human cytomegalovirus (CMV) promoter-based mammalian gene expression vector. CMV promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines. A target gene can be conveniently cloned into pGEN2.1 vector at multiple cloning sites (MCS). The target protein is expressed with the FLAG tag at the N-terminal. This tag will facilitate detection and purification of the target protein using commercially available tag-specific antibodies. This vector also contains a selectable marker for mammalian cells, neomycin phosphotransferase gene, under SV40 promoter. pGen2.1 vector can be used for either transient expression or stable expression in the presence of the antibiotic G418.
Polylinker Start 950
Polylinker End 986
Cmv Start 251
Cmv End 818
Sv40 Start 2046
Neo End 3226
Neo Start 2432
Amp End 5588
Amp Start 4728
F1 End 2022
F1 Start 1594
Cole1 Ori End 4768
Cole1 Ori Start 3786
Sv40 End 2391
Forward Sequencing Primer TAATACGACTCACTATAGGG
Reverse Sequencing Primer CTAGTCAGACAAAATGATGC
Sequence
gacggatcgggagatctcccgatcccctatggtgcactctcagtacaatctgctctgatg
ccgcatagttaagccagtatctgctccctgcttgtgtgttggaggtcgctgagtagtgcg
cgagcaaaatttaagctacaacaaggcaaggcttgaccgacaattgcatgaagaatctgc
ttagggttaggcgttttgcgctgcttcgcgatgtacgggccagatatacgcgttgacatt
gattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatata
tggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacc
cccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttcc
attgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgt
atcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcatt
atgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtca
tcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttg
actcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcacc
aaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcg
gtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactagagaaccca
ctgcttactggcttatcgaaattaatacgactcactatagggagacccaagctggctagc
gtttaaacttaagcttacaagtttgtacaaaaaagcaggctgccaccatggattacaagg
atgacgacgataaggcggccgcttcagcatgcatctagaggatccacccagctttcttgt
acaaagtggtgggccctattctatagtgtcacctaaatcgctagagctcgctgatcacgg
gtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagt
gcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtcctt
ctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggatgacaac
ctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggct
cactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgtt
gggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacgggg
tttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttg
gcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtccttgaaga
caatagcaggcatgctggggatgcggtgggctctatggcttctgaggcggaaagaaccag
ctggggctctagggggtatccccacgcgccctgtagcggcgcattaagcgcggcgggtgt
ggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgc
tttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggg
gctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgatta
gggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgtt
ggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctat
ctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaa
tgagctgatttaacaaaaatttaacgcgaattaattctgtggaatgtgtgtcagttaggg
tgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattag
tcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatg
catctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaact
ccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagag
gccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggc
ctaggcttttgcaaaaagctcccgggagcttgtatatccattttcggatctgatcaagag
acaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggcc
gcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgat
gccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctg
tccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacg
ggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgcta
ttgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagta
tccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattc
gaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtc
gatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccagg
ctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttg
ccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggt
gtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggc
ggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgc
atcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgaaatga
ccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatg
aaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcgggg
atctcatgctggagttcttcgcccaccccaacttgtttattgcagcttataatggttaca
aataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagtt
gtggtttgtccaaactcatcaatgtatcttatcatgtctgtataccgtcgacctctagct
agagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaa
ttccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtga
gctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgt
gccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgct
cttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtat
cagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaaga
acatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt
ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggt
ggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgc
gctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaa
gcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgct
ccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggta
actatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactg
gtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggc
ctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagtta
ccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtt
tttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttga
tcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca
tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaat
caatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgagg
cacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgt
agataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgag
acccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagc
gcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaag
ctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggca
tcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaa
ggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccga
tcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcata
attctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaacca
agtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacggg
ataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcgg
ggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtg
cacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacag
gaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatac
tcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggataca
tatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaag
tgccacctgacgtc

Storage -20°C

  • PGen2.1
  • PGen2.1




请点击此处查找更多相关文献






更多产品文件类型 >>

产品编号: SD0122
规格
价格
SD0122 10 ug ¥1750.00