|
|||||||||||||||
Description: pRNA-CMV3.1/Neo/CTL is a Genscript general-purpose siRNA negative control vector. It is designed for mammalian transfection. It uses a CMV promoter for siRNA expression. The sense sequence shows no homology to any mouse or rats mRNA sequence in the NCBI RefSeq database. This vector can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:tm0172 | |||||||||||||||
| Forward Sequencing Primer: DA0023:pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:584-651 | |||||||||||||||
| CMV Promoter:1-583 | |||||||||||||||
| SV40:1267-1612 | |||||||||||||||
| Neomycin:1653-2447 | |||||||||||||||
| pUC ori:3161-3801 | |||||||||||||||
| Ampicillin:3949-4809 | |||||||||||||||
|
DATASHEET: 20051024035259 (PDF) |
|||||||||||||||
