|
|||||||||||||||
Description: pRNA-H1.1/Neo/CTL is a Genscript general-purpose siRNA negative control vector. It is designed for mammalian transfection. It uses an H1 promoter for siRNA expression. The sense sequence shows no homology to any mouse or rat mRNA sequence in the NCBI RefSeq database. It can be used as a negative control and as a siRNA vector. This vector employs BamH I and Hind III for siRNA insertion. |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:4700-4767 | |||||||||||||||
| H1 Promoter:4600-4699 | |||||||||||||||
| SV40:647-992 | |||||||||||||||
| Neomycin:1033-1827 | |||||||||||||||
| pUC ori:2541-3181 | |||||||||||||||
| Ampicillin:3329-4189 | |||||||||||||||
|
DATASHEET: 20051024034858 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050506154231 (PDF) |
|||||||||||||||