|
|||||||||||||||
Description: pRNA-H1.1/Neo/sicGFP is a Genscript siRNA expression vector. It is designed for mammalian transfection. It uses an H1 promoter for siRNA expression. This vector contains an siRNA construct for cGFP (coral green fluorescence protein) and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:4703-4777 | |||||||||||||||
| H1 Promoter:4600-4699 | |||||||||||||||
| SV40:647-992 | |||||||||||||||
| Neomycin:1033-1827 | |||||||||||||||
| pUC ori:2541-3181 | |||||||||||||||
| Ampicillin:3329-4189 | |||||||||||||||
|
DATASHEET: 20051024034440 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(￥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |