|
|||||||||||||||
Description: pRNA-H1.1/Hygro/siRLuc is a Genscript siRNA expression vector. It is designed for mammalian transfection. It uses H1 promoter for siRNA expression. This vector contains siRNA construct for Renilla luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:4819-4888 | |||||||||||||||
| H1 Promoter:4719-4818 | |||||||||||||||
| SV40:597-942 | |||||||||||||||
| Hygromycin:965-1990 | |||||||||||||||
| pUC ori:2660-3300 | |||||||||||||||
| Ampicillin:3448-4308 | |||||||||||||||
|
DATASHEET: 20051024033918 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050506154231 (PDF) |
|||||||||||||||