|
|||||||||||||||
Description: pRNA-U6.1/Hygro/siRLuc is a Genscript siRNA expression vector. It is designed for mammalian transfection. It uses a U6 promoter for siRNA expression. This vector contains siRNA construct for Renilla luciferase and can be used as a positive control. It can also be used as an siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0011:pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:78-147 | |||||||||||||||
| U6 Promoter:5044-77 | |||||||||||||||
| SV40:896-1241 | |||||||||||||||
| Hygromycin:1264-2289 | |||||||||||||||
| pUC ori:2959-3599 | |||||||||||||||
| Ampicillin:3747-4607 | |||||||||||||||
|
PRODUCTINFO: 20051024033254 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050506154231 (PDF) |
|||||||||||||||
