|
|||||||||||||||
Description: a Genscript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. This vector contains the siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0032:SD1563 Forward (CTGGGAAATCACCATAAACG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| CMV IE:7-490 | |||||||||||||||
| siFluc:596-653 | |||||||||||||||
| Polylinker:590-659 | |||||||||||||||
| H1 Promoter:497-591 | |||||||||||||||
| CMV Promoter:698-1285 | |||||||||||||||
| cGFP:1302-2021 | |||||||||||||||
| SV40:2710-3055 | |||||||||||||||
| Hygromycin:3078-4103 | |||||||||||||||
| pUC ori:4773-5413 | |||||||||||||||
| Ampicillin:5561-6421 | |||||||||||||||
|
DATASHEET: 20051215031925 (PDF) |
|||||||||||||||