|
|||||||||||||||
Description: pRNAT-H1.3/Hygro is a Genscript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell lines. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a CMV-enhanced H1 promoter for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites.
|
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0032:SD1563 Forward (CTGGGAAATCACCATAAACG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| CMV IE:7-490 | |||||||||||||||
| Polylinker:590-659 | |||||||||||||||
| H1 Promoter:497-591 | |||||||||||||||
| CMV Promoter:698-1285 | |||||||||||||||
| cGFP:1302-2021 | |||||||||||||||
| SV40:2710-3055 | |||||||||||||||
| Hygromycin:3078-4103 | |||||||||||||||
| pUC ori:4773-5413 | |||||||||||||||
| Ampicillin:5561-6421 | |||||||||||||||
|
Publications used this GenScript Product: |
|||||||||||||||
|
|
|||||||||||||||
|
PRODUCTINFO: 20051024032633 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(¥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |