|
|||||||||||||||
Description: pRNA-H1.3/Neo is a Genscript siRNA expression vector. It is designed for mammalian transfection. It uses an enhanced H1 promoter (enhanced by a CMV enhancer just before H1 promoter) for siRNA expression. The siRNA insert can be cloned between BamH I and Hind III sites. |
|||||||||||||||
![]() |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0024:pRNA-H1.3 Forward (GACGTCAATGGGAGTTTGTT) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| CMV IE:4559-5042 | |||||||||||||||
| siFluc:5148-5205 | |||||||||||||||
| Polylinker:5142-5211 | |||||||||||||||
| H1 Promoter:5049-5143 | |||||||||||||||
| SV40:647-992 | |||||||||||||||
| Neomycin:1033-1827 | |||||||||||||||
| pUC ori:2541-3181 | |||||||||||||||
| Ampicillin:3329-4189 | |||||||||||||||
|
PRODUCTINFO: 20051024025951 (PDF) |
|||||||||||||||