|
|||||||||||||||
Description: pRNA-U6.3/Neo/siFluc is a Genscript siRNA expression vector. It is designed for mammalian transfection. It uses U6 promoter for siRNA expression. This vector contains siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
 |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0011:pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| CMV IE:4807-5290 | |||||||||||||||
| siFluc:84-141 | |||||||||||||||
| Polylinker:78-147 | |||||||||||||||
| U6 Promoter:5298-77 | |||||||||||||||
| SV40:896-1241 | |||||||||||||||
| Neomycin:1282-2076 | |||||||||||||||
| pUC ori:2790-3430 | |||||||||||||||
| Ampicillin:3578-4438 | |||||||||||||||
