|
|||||||||||||||
Description: pRNA-CMV3.1/Neo/siFLuc is a Genscript siRNA expression vector. It is designed for mammalian transfection. It uses a CMV promoter for siRNA expression. This vector contains a siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0172 | |||||||||||||||
| Forward Sequencing Primer: DA0023:pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:584-653 | |||||||||||||||
| CMV Promoter:1-583 | |||||||||||||||
| SV40:1269-1614 | |||||||||||||||
| Neomycin:1655-2449 | |||||||||||||||
| pUC ori:3163-3803 | |||||||||||||||
| Ampicillin:3951-4811 | |||||||||||||||
|
PRODUCTINFO: 20051024024902 (PDF) |
|||||||||||||||