|
|||||||||||||||
Description: pRNATin-H1.2/Neo/siFluc is a Genscript siRNA expression vector. It is designed for mammalian transfection. The GFP marker (coral GFP, cGFP) , which is under CMV promoter control, can be used to track the transfection efficiency. It uses the H1.2 promoter, an engineered inducible promoter containing a tetracycline operator (TetO1), for siRNA expression. This vector contains an siRNA construct for firefly luciferase and can be used as a positive control. It can also be used as an siRNA vector using BamH I and Hind III for siRNA insertion.
|
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:6168-64 | |||||||||||||||
| H1 Promoter:6068-6167 | |||||||||||||||
| CMV Promoter:103-691 | |||||||||||||||
| cGFP:707-1426 | |||||||||||||||
| SV40:2115-2460 | |||||||||||||||
| Neomycin:2501-3295 | |||||||||||||||
| pUC ori:4009-4649 | |||||||||||||||
| Ampicillin:4797-5657 | |||||||||||||||
|
PRODUCTINFO: 20051024024323 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050506154231 (PDF) |
|||||||||||||||