|
|||||||||||||||
Description: pRNA-H1.1/Neo/siFLuc is a Genscript siRNA expression vector. It is designed for mammalian transfection. It uses H1 promoter for siRNA expression. This vector contains siRNA construct for Firefly luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion. |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:4700-4769 | |||||||||||||||
| H1 Promoter:4600-4699 | |||||||||||||||
| SV40:647-992 | |||||||||||||||
| Neomycin:1033-1827 | |||||||||||||||
| pUC ori:2541-3181 | |||||||||||||||
| Ampicillin:3329-4189 | |||||||||||||||
|
DATASHEET: 20051024023628 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050506154231 (PDF) |
|||||||||||||||
