|
|||||||||||||||
| The human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on the RNA polymerase II system, the CMV promoter drives higher-level constitutive expression of genes in a greater variety of mammalian cell lines, than RNA-polymerase III-based promoters such as U6 and H1. In this vector, a CMV promoter drives the expression of siRNA, and an SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Xho I sites. | |||||||||||||||
 |
|||||||||||||||
| Download Protocol:tm0172 | |||||||||||||||
| Forward Sequencing Primer: DA0023:pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Puromycin:2911-3510 | |||||||||||||||
| Polylinker:584-651 | |||||||||||||||
| CMV Promoter:1-583 | |||||||||||||||
| cGFP:1598-2317 | |||||||||||||||
| SV40:1267-1598 | |||||||||||||||
| pUC ori:4210-4850 | |||||||||||||||
| Ampicillin:4998-5858 | |||||||||||||||
|
PRODUCTINFO: 20051114033755 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050718094354 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(￥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |