|
|||||||||||||||
| Human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a greater variety of mammalian cell lines than RNA-polymerase-III-based promoters such as U6 and H1. In this vector, the CMV promoter drives the expression of siRNA and a SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Afl II sites. The siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5?TAGAAGGCACAGTCGAGG-3?. This vector also carries cGFP (coral GFP) for convenient tracking of transfection efficiency. | |||||||||||||||
 |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:tm0172 | |||||||||||||||
| Forward Sequencing Primer: DA0023:pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:584-651 | |||||||||||||||
| CMV Promoter:1-583 | |||||||||||||||
| cGFP:1598-2317 | |||||||||||||||
| SV40:1267-1598 | |||||||||||||||
| Neomycin:2936-3730 | |||||||||||||||
| pUC ori:4444-5084 | |||||||||||||||
| Ampicillin:5232-6092 | |||||||||||||||
|
PRODUCTINFO: 20051024021421 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050718094354 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(￥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |