|
|||||||||||||||
Description: pRNAT-U6.2/Lenti siRNA expression vector is compatible with the Invitrogen ViraPowerTM Lentiviral_Expression System. It is designed for siRNA expression in both dividing and nondividing cells. The siRNA insert can be conveniently cloned between the BamH I and Xho I sites under the control of the U6 promoter. The vector contains a neomycin resistance gene for establishing stable cell lines and a coral GFP gene for tracking transfection efficiency. Both of these are driven by CM and SV40 promoters, respectively. The vector uses HIV 3'LTR for viral transcription and a Rous sarcoma enhancer/promoter joined to HIV 5'LTR (PRSV/5'LTR) for packaging. |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0175 | |||||||||||||||
| Forward Sequencing Primer: DA0011:pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| 5' LTR:1-410 | |||||||||||||||
| 3' LTR:4906-5140 | |||||||||||||||
| ColE1 ori:7220-8106 | |||||||||||||||
| Polylinker:2200-2275 | |||||||||||||||
| U6 Promoter:1873-2199 | |||||||||||||||
| CMV Promoter:2320-2907 | |||||||||||||||
| cGFP:2924-3643 | |||||||||||||||
| SV40:3651-3996 | |||||||||||||||
| Neomycin:4037-4831 | |||||||||||||||
| Ampicillin:6300-7160 | |||||||||||||||
|
MSDS: 20080228014414 (PDF) |
|||||||||||||||
|
PRODUCTINFO: 20051115220744 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050506171639 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(¥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |