|
|||||||||||||||
Description: pRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives the siRNA expression with the siRNA insert cloned between MluⅠ and XhoⅠsites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5???TR (CMV/MSV 5'LTR) and MSV 3'LTR for viral transcription and packaging. |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:TM0187 | |||||||||||||||
| Forward Sequencing Primer: DA0025:SD1241 Forward (TGTAGGTTTGGCAAGCTAGC) |
|||||||||||||||
| Reverse Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| 5' LTR:1-727 | |||||||||||||||
| 3' LTR:5460-5755 | |||||||||||||||
| psi+:757-1566 | |||||||||||||||
| ColE1 ori:6456-7342 | |||||||||||||||
| SV40 ori \& promoter:6012-6356 | |||||||||||||||
| IRES:2975-3555 | |||||||||||||||
| Polylinker:5288-5311 | |||||||||||||||
| H1 Promoter:5312-5411 | |||||||||||||||
| CMV Promoter:1604-2132 | |||||||||||||||
| cGFP:2247-2966 | |||||||||||||||
| Hygromycin:3593-4613 | |||||||||||||||
| Ampicillin:7402-8262 | |||||||||||||||
|
PRODUCTINFO: 20051123022221 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(￥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |