|
|||||||||||||||
Description: pRNA-H1.1/Retro siRNA expression vector is compatible with Clontech Retro-X Expression System. An H1 promoter drives siRNA expression. the siRNA insert cloned between the Mlu and Xho sites. The vector contains a hygromycin resistance gene under the control of cytomegalovirus (CMV) promoter* for establishing stable cell line. The vector uses CMV enhancer/promoter joined MSV 5???TR (CMV/MSV 5'LTR). It uses MSV 3'LTR for viral transcription and packaging. |
|||||||||||||||
 |
|||||||||||||||
 |
|||||||||||||||
| Download Protocol:TM0187 | |||||||||||||||
| Forward Sequencing Primer: DA0025:SD1241 Forward (TGTAGGTTTGGCAAGCTAGC) |
|||||||||||||||
| Reverse Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| 5' LTR:1-727 | |||||||||||||||
| 3' LTR:4768-5063 | |||||||||||||||
| psi+:757-1566 | |||||||||||||||
| ColE1 ori:6650-5764 | |||||||||||||||
| SV40 ori \& promoter:5320-5664 | |||||||||||||||
| Polylinker:4596-4619 | |||||||||||||||
| H1 Promoter:4719-4620 | |||||||||||||||
| CMV Promoter:1604-2132 | |||||||||||||||
| Hygromycin:2901-3921 | |||||||||||||||
| Ampicillin:7570-6710 | |||||||||||||||
|
Publications used this GenScript Product: |
|||||||||||||||
|
|
|||||||||||||||
|
PRODUCTINFO: 20051024014300 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050708115745 (PDF) |
|||||||||||||||
