|
|||||||||||||||
Description: pRNAin-H1.2/Shuttle is a Genscript adenoviral siRNA shuttle vector. It is compatible with Clontech Adeno-XTM Expression System 1. It uses an inducible H1 promoter* for siRNA expression. This promoter contains a tetracycline operator (TetO1). As a competitor, tetracycline or doxycycline can bind this operator to remove the blockade of tetracycline repressor (TetR) from H1 promoter and induce the transcription of siRNA.
pRNAin-H1.2/Shuttle is designed for mammalian transfection. It also contains a neomycin resistance gene under SV40 promoter control for establishing stable cell line. |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0165 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:4727-4750 | |||||||||||||||
| H1 Promoter:4627-4726 | |||||||||||||||
| SV40:674-1019 | |||||||||||||||
| Neomycin:1060-1854 | |||||||||||||||
| pUC ori:2568-3208 | |||||||||||||||
| Ampicillin:3356-4216 | |||||||||||||||
|
DATASHEET: 20051023235958 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050517003536 (PDF) |
|||||||||||||||