|
|||||||||||||||
| Human cytomegalovirus (CMV) promoter is one of the strongest promoters described. Based on RNA polymerase II system, CMV promoter drives higher-level constitutive expression of genes in a variety of mammalian cell lines, compared with RNA polymerase III based promoters such as U6 and H1. In this vector, CMV promoter drives the expression of siRNA, and SV40 promoter drives the expression of the resistance gene. siRNA cassettes can be easily inserted into the vectors between BamH I and Hind III sites. siRNA sequence can be confirmed by DNA sequencing using Reverse Sequencing Primer DA0012 (5?TAGAAGGCACAGTCGAGG-3? | |||||||||||||||
![]() |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0172 | |||||||||||||||
| Forward Sequencing Primer: DA0023:pRNA-CMV Forward (GTACGGTGGGAGGTCTATAT) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:584-651 | |||||||||||||||
| CMV Promoter:1-583 | |||||||||||||||
| SV40:1267-1612 | |||||||||||||||
| Hygromycin:1635-2654 | |||||||||||||||
| pUC ori:3330-3970 | |||||||||||||||
| Ampicillin:4118-4978 | |||||||||||||||
|
Publications used this GenScript Product: |
|||||||||||||||
|
|
|||||||||||||||
|
PRODUCTINFO: 20051023233408 (PDF) |
|||||||||||||||
|
PROTOCOL: 20050718094354 (PDF) |
|||||||||||||||