|
|||||||||||||||
Description: pRNATin-H1.2/Neo is a Genscript inducible siRNA expression vector. The H1.2 promoter is an engineered inducible promoter* containing a tetracycline operator (TetO1). The Tetracycline operator itself has no effect on expression unless the tetracycline repressor (TetR) is present. In the presence of TetR, the promoter effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site and derepressing the transcription from the H1 promoter.
pRNATin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene, which can be used for establishing stable cell lines, and a GFP (coral GFP) marker under CMV promoter** control to track transfection efficiency.
|
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:6122-18 | |||||||||||||||
| H1 Promoter:6022-6121 | |||||||||||||||
| CMV Promoter:57-644 | |||||||||||||||
| cGFP:661-1380 | |||||||||||||||
| SV40:2069-2414 | |||||||||||||||
| Neomycin:2455-3249 | |||||||||||||||
| pUC ori:3963-4603 | |||||||||||||||
| Ampicillin:4751-5611 | |||||||||||||||
|
Publications used this GenScript Product: |
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
PRODUCTINFO: 20051023225522 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(¥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |