|
|||||||||||||||
Description: pRNAin-H1.2/Neo is a Genscript inducible siRNA expression vector. The H1.2 promoter is an inducible promoter* containing a tetracycline operator (TetO1). The tetracycline operator itself has no effect on expression. When the tetracycline repressor (TetR) is present, it effectively binds the TetO1 and blocks the transcription. In the presence of tetracycline or doxycycline, the inducer binds TetR and causes the TetR protein to release the TetO1 site, derepressing the transcription from the H1 promoter.
pRNAin-H1.2/Neo is designed for mammalian transfection. It carries a neomycin resistance gene that can be used for establishing stable cell line. |
|||||||||||||||
![]() |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:4700-4770 | |||||||||||||||
| H1 Promoter:4600-4699 | |||||||||||||||
| SV40:647-992 | |||||||||||||||
| Neomycin:1033-1827 | |||||||||||||||
| pUC ori:2541-3181 | |||||||||||||||
| Ampicillin:3329-4189 | |||||||||||||||
|
Publications used this GenScript Product: |
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
PRODUCTINFO: 20051023225307 (PDF) |
|||||||||||||||