|
|||||||||||||||
Description: Genscript pRNAT-H1.1/Adeno is an adenoviral siRNA shuttle vector. It is compatible with the Stratagene AdEasy Adenoviral Vector System. The vector is designed for transfection in mammalian cells. An H1 promoter is used to drive siRNA expression. The vector contains a cGFP marker under the control of cytomegalovirus (CMV) promoter*, which can be used to track transfection efficiency. The vector also contains a kanamycin resistance gene for transformant selection. LITR and RITR regions are available in this vector for recombinant viral DNA replication. |
|||||||||||||||
![]() |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0165 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0014:pShuttle-H1.1 Reverse (CAAAACTACATAAGACCCCCAC) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| pBR322 origin:5602-6269 | |||||||||||||||
| Kanamycin:7059-7850 | |||||||||||||||
| Polylinker:2112-2141 | |||||||||||||||
| H1 Promoter:2012-2111 | |||||||||||||||
| CMV Promoter:1944-1356 | |||||||||||||||
| cGFP:1333-622 | |||||||||||||||
|
Publications used this GenScript Product: |
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
PRODUCTINFO: 20051023224708 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(¥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |