pRNAT-H1.1/Shuttle |
| Cat. No. |
Name |
Size |
Price(￥) |
SD1216
 |
pRNAT-H1.1/Shuttle |
10 ug |
3850.00
|
| FullName |
pRNAT-H1.1/Shuttle |
|
|
|
Description: pRNAT-H1.1/Shuttle is an adenoviral siRNA shuttle vector. It is compatible with the Clontech Adeno-XTM Expression System 1. It carries a GFP marker (coral GFP, cGFP) under CMV promoter control. This marker can be used to track the transfection efficiency. It uses an H1 promoter for siRNA expression.
|
 |
| Download Protocol:tm0165 |
Forward Sequencing Primer:
DA0013:pRNA-H1 Forward
(TAATACGACTCACTATAGGG)
|
Reverse Sequencing Primer:
DA0012:pRNA Reverse
(TAGAAGGCACAGTCGAGG)
|
Detailed Map:
|
| Polylinker:6164-6187 |
| H1 Promoter:6064-6163 |
| CMV Promoter:37-624 |
| cGFP:641-1357 |
| SV40:2085-2430 |
| Neomycin:2471-3265 |
| pUC ori:3979-4619 |
| Ampicillin:4767-5627 |
Publications used this GenScript Product:
|
Jiliang Zhou and B. Paul Herring. Mechanisms responsible for the promoter specific effects of myocardin.
J. Biol. Chem. Jan 2005;
280
(11)
:10861-10869
|
El-Mounayri OA, Triplett JW, Yates CW, Herring BP.
Regulation of smooth muscle-specific gene expression by homeodomain proteins, Hoxa-10 and Hoxb-8.
J. Biol. Chem. Jul 2005;
280
(27)
:25854-25863
|
Feng Yin, April M Hoggatt, Jiliang Zhou, and B. Paul Herring. The 130kDa Smooth Muscle Myosin Light Chain Kinase is Transcribed from a CArG-Dependent, Internal Promoter Within the Mouse MYLK Gene. Am. J. Physiol Cell Physiol. Jun 2006;
290
(6)
:C1599-1609
|
Nakerakanti SS, Kapanadze B, Yamasaki M, Markiewicz M, Trojanowska M.
FLI1 and Ets1 have distinct roles in the CTGF/CCN2 gene regulation and induction of the profibrotic gene program.
J. Biol. Chem. Sep 2006;
281
(35)
:25259-25269
|
Pannu J, Nakerakanti S, Smith E, Dijke PT, Trojanowska M. TGF-beta receptor type Idependent fibrogenic gene program is mediated via activation of smad1 and ERK1/2 pathways.
J. Biol. Chem. Apr 2007;
282
(14)
:10405-10413
|
Yoshihide Asano, Joanna Czuwara-Ladykowska, Maria Trojanowska. TGF-β regulates DNA binding activity of transcription factor Fli1 by PCAF-dependent acetylation.
J. Biol. Chem. Nov 2007;
282
(48)
:34672 - 34683
|
Liling Yang, Shuxing Wang, Backil Sung, Grewo Lim, and Jianren Mao. Morphine induces ubiquitin-proteasome activity and glutamate transporter degradation. J. Biol. Chem. Jun 2008;
|
PRODUCTINFO:
20051023224312 (PDF)
|
PROTOCOL:
20050517003536 (PDF)
|
