|
|||||||||||||||
Description: pRNAT-H1.1/Neo is a Genscript siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene as the selectable marker which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses H1 promoter for siRNA expression. |
|||||||||||||||
![]() |
|||||||||||||||
| Download Protocol:tm0169 | |||||||||||||||
| Forward Sequencing Primer: DA0013:pRNA-H1 Forward (TAATACGACTCACTATAGGG) |
|||||||||||||||
| Reverse Sequencing Primer: DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG) |
|||||||||||||||
| Detailed Map: |
|||||||||||||||
| Polylinker:6102-6125 | |||||||||||||||
| H1 Promoter:6002-6101 | |||||||||||||||
| CMV Promoter:37-624 | |||||||||||||||
| cGFP:641-1360 | |||||||||||||||
| SV40:2049-2394 | |||||||||||||||
| Neomycin:2435-3229 | |||||||||||||||
| pUC ori:3943-4583 | |||||||||||||||
| Ampicillin:4731-5591 | |||||||||||||||
|
Publications used this GenScript Product: |
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
|
|||||||||||||||
|
PRODUCTINFO: 20051023223311 (PDF) |
|||||||||||||||
| Cat. No. | Name | Size | Price(¥) |
|---|---|---|---|
| A00185 |
antibody : cGFP-tag Antibody, mAb, Mouse | 40 | 550.00 |
| 200 |