pRNAT-U6.1/Hygro
Cat. No. Name Size Price(￥)
SD1212 
 pRNAT-U6.1/Hygro  10 ug  3850.00 
FullName pRNAT-U6.1/Hygro


Description: pRNAT-U6.1/Hygro is a Genscript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene as a selectable marker, which can be used for establishing stable cell line. It also has a coral GFP marker (cGFP) under CMV promoter control, which can be used to track the transfection efficiency. It uses a U6 promoter for siRNA expression.
Download Protocol:tm0169
Forward Sequencing Primer:
DA0011:pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)
Reverse Sequencing Primer:
DA0012:pRNA Reverse (TAGAAGGCACAGTCGAGG)
Detailed Map:
Polylinker:78-101
U6 Promoter:6300-77
CMV Promoter:140-727
cGFP:744-1463
SV40:2152-2497
Hygromycin:2520-3545
pUC ori:4215-4855
Ampicillin:5003-5863
Publications used this GenScript Product:
  • Ping Gao, Ronald L Wange, Ning Zhang, Joost J Oppenheim, and O. M.Zack Howard. Negative regulation of CXCR4-mediated chemotaxis by the lipid phosphatase activity of tumor suppressor PTEN. Blood. Jun 2005; 106 (8) :2619-2626


  • Gonczi M, Szentandrassy N, Johnson IT, Heagerty AM, Weston AH. Investigation of the role of TASK-2 channels in rat pulmonary arteries; pharmacological and functional studies following RNA interference procedures. Br. J. Pharmacol. Mar 2006; 147 (5) :496-505


  • Hellebrekers DM, Melotte V, Vire E, Langenkamp E, Molema G, Fuks F, Herman JG, Van Criekinge W, Griffioen AW, van Engeland M. Identification of epigenetically silenced genes in tumor endothelial cells. Cancer Res. May 2007; 67 (9) :4138-4148


  • Michael J. MacDonald, Andrew D. Smith, III, Noaman M. Hasan, Grzegorz Sabat, and Leonard A. Fahien. Feasibility of pathways for transfer of acyl groups from mitochondria to the cytosol to form short chain acyl-CoAs in the pancreatic beta cell. J. Biol. Chem. Oct 2007; 282 :30596 - 30606


  • Ming Kei Lee and Kanaga Sabapathy. The R246S hot-spot p53 mutant exerts dominant-negative effects in embryonic stem cells in vitro and in vivo. J. Cell Sci. Jun 2008; 121 (11) :1899 - 1906


    • PRODUCTINFO:
    20051023221302 (PDF)

    Related Products:
    Cat. No. Name Size Price(￥)
    A00185 
    		 antibody : cGFP-tag Antibody, mAb, Mouse  40  550.00 
    200 
    2475.00