pRNAT-U6.1/Neo |
| Cat. No. |
Name |
Size |
Price(￥) |
SD1211
 |
pRNAT-U6.1/Neo |
10 ug |
3850.00
|
| FullName |
pRNAT-U6.1/Neo |
|
|
|
Description: pRNAT-U6.1/Neo is a Genscript siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene as the selectable marker, which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses U6 promoter for siRNA expression.
|
 |
| Download Protocol:tm0169 |
Forward Sequencing Primer:
DA0011:pRNA-U6 Forward
(TACGATACAAGGCTGTTAGAGAG)
|
Reverse Sequencing Primer:
DA0012:pRNA Reverse
(TAGAAGGCACAGTCGAGG)
|
Detailed Map:
|
| Polylinker:78-101 |
| U6 Promoter:6131-77 |
| CMV Promoter:140-727 |
| cGFP:745-1463 |
| SV40:2152-2497 |
| Neomycin:2538-3332 |
| pUC ori:4046-4686 |
| Ampicillin:4834-5694 |
Publications used this GenScript Product:
|
Cheikh I. Seye, Ningpu Yu, Fernando A. Gonzalez, Laurie Erb, and Gary A. Weisman. The P2Y2 Nucleotide Receptor Mediates Vascular Cell Adhesion Molecule-1 Expression through Interaction with VEGF Receptor-2 (KDR/Flk-1). J. Biol. Chem. Aug 2004;
279
(34)
:35679-35686
|
Sheng Wang, Baohua Zhang, and Douglas V Faller. BRG1/BRM and prohibitin are required for growth suppression by estrogen antagonists. EMBO. J. Jun 2004;
23
(11)
:2293-2303
|
Okaya A, Kitanaka J, Kitanaka N, Satake M, Kim Y, Terada K, Sugiyama T, Takemura M, Fujimoto J, Terada N, Miyajima A, Tsujimura T.
Oncostatin M inhibits proliferation of rat oval cells, OC15-5, inducing differentiation into hepatocytes.
Am. J. Pathol. Mar 2005;
166
(3)
:709-719
|
Toshio Hamatani, Geppino Falco, Mark G. Carter, Hidenori Akutsu, Carole A. Stagg, Alexei A. Sharov, Dawood B. Dudekula, Vincent VanBuren, and Minoru S.H. Ko. Age-associated alteration of gene expression patterns in mouse oocytes. Hum. Mol. Genet. Oct 2004;
13
(19)
:2263-2278
|
Jin H. Song, Margaret C.L. Tse, Anita Bellail, Surasak Phuphanich, Fadlo Khuri, Norman M. Kneteman and Chunhai Hao. Lipid Rafts and Nonrafts Mediate Tumor Necrosis Factor?CRelated Apoptosis-Inducing Ligand?CInduced Apoptotic and Nonapoptotic Signals in Non?CSmall Cell Lung Carcinoma Cells. Cancer Research. Jul 2007;
67
(14)
:6946-6955
|
Jin-Wu Tsai, K Helen Bremner ,Richard B Vallee Dual subcellular roles for LIS1 and dynein in radial neuronal migration in live brain tissue Nat. Neurosci. Aug 2007;
10
(8)
:970-979
|
PRODUCTINFO:
20051023220029 (PDF)
|
