pRNA-H1.1/Neo |
| Cat. No. |
Name |
Size |
Price(¥) |
SD1203
 |
pRNA-H1.1/Neo |
10 ug |
2475.00
|
| FullName |
pRNA-H1.1/Neo |
|
|
|
Description: pRNA-H1.1/Neo is a Genscript siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene which can be used for establishing stable cell line. It uses H1 promoter for siRNA expression.
|
 |
| Download Protocol:tm0169 |
Forward Sequencing Primer: DA0013:pRNA-H1 Forward
(TAATACGACTCACTATAGGG)
|
Reverse Sequencing Primer: DA0012:pRNA Reverse
(TAGAAGGCACAGTCGAGG)
|
Detailed Map:
|
| Polylinker:4700-4723 |
| H1 Promoter:4600-4699 |
| SV40:647-992 |
| Neomycin:1033-1827 |
| pUC ori:2541-3181 |
| Ampicillin:3329-4189 |
Publications used this GenScript Product:
|
Orlando Piro and George J. Broze, Jr. Role for the Kunitz-3 Domain of Tissue Factor Pathway Inhibitor-α in Cell Surface Binding. Circulation. Dec 2004;
110
(23)
:3567-3572
|
Asish K. Ghosh, Robert Steele, and Ratna B. Ray. c-myc Promoter-binding Protein 1 (MBP-1) Regulates Prostate
Cancer Cell Growth by Inhibiting MAPK Pathway. J. Biol. Chem. Apr 2005;
280
(14)
:14325-14330
|
Roberta Fiume, Irene Faenza, Alessandro Matteucci, Annalisa Astolfi, Marco Vitale, Alberto Maria Martelli, and Lucio Cocco. Nuclear PLCbeta 1 affects CD24 expression in murine erythroleukemia cells. J. Biol. Chem. Jun 2005;
280
(25)
:24221-24226
|
Asish K. Ghosh, Robert Steele, and Ratna B. Ray. MBP-1 regulates prostate cancer cell growth by inhibiting MAP kinase pathway. J. Biol. Chem. Apr 2005;
280
(14)
:14325-14330
|
Livigni A, Scorziello A, Agnese S, Adornetto A, Carlucci A, Garbi C, Castaldo I, Annunziato L, Avvedimento EV, Feliciello A.
Mitochondrial AKAP121 links cAMP and src signalling to oxidative metabolism. Mol.Biol.Cell. Jan 2006;
17
(1)
:263-271
|
Asish K. Ghsoh, Robert Steele, and Ratna B. Ray. Knockdown of MBP-1 in human prostate cancer cells delays cell cycle progression.
J. Biol. Chem. Aug 2006;
281
(33)
:23652-23657
|
Huang Y, Kang BN, Tian J, Liu Y, Luo HR, Hester L, Snyder SH.
The cationic amino acid transporters CAT1 and CAT3 mediate NMDA receptor activation-dependent changes in elaboration of neuronal processes via the mammalian target of rapamycin mTOR pathway.
J. Neurosci. Jan 2007;
27
(3)
:449-458
|
PRODUCTINFO:
20051023212019 (PDF)
|