pRNA-U6.1/Hygro |
| Cat. No. |
Name |
Size |
Price(¥) |
SD1202
 |
pRNA-U6.1/Hygro |
10 ug |
2475.00
|
| FullName |
pRNA-U6.1/Hygro |
|
|
|
Description: pRNA-U6.1/Hygro is a Genscript siRNA expression vector. It is designed for mammalian transfection. It carries a hygromycin resistance gene that can be used for establishing stable cell lines. It uses a U6 promoter for siRNA expression.
|
 |
| Download Protocol:tm0169 |
Forward Sequencing Primer: DA0011:pRNA-U6 Forward
(TACGATACAAGGCTGTTAGAGAG)
|
Reverse Sequencing Primer: DA0012:pRNA Reverse
(TAGAAGGCACAGTCGAGG)
|
Detailed Map:
|
| Polylinker:78-101 |
| U6 Promoter:4998-77 |
| SV40:850-1195 |
| Hygromycin:1218-2243 |
| pUC ori:2913-3553 |
| Ampicillin:3701-4561 |
Publications used this GenScript Product:
|
Suzanne Benjannet, David Rhainds, Rachid Essalmani, Janice Mayne, Louise Wickham, Weijun Jin, Marie-Claude Asselin, Josée Hamelin, Mathilde Varret, Delphine Allard, Mélanie Trillard, Marianne Abifadel, Angie Tebon, Alan D Attie, Daniel J Rader, Catherine Boileau, Louise Brissette, Michel Chrétien, Annik Prat, and Nabil G Seidah. NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the LDLR and LDL-cholesterol. J. Biol. Chem. Nov 2004;
279
(47)
:48865-48875
|
Daisuke Kamei, Kiyofumi Yamakawa, Yui Takegoshi, Maya Mikami-Nakanishi, Yoshihito Nakatani, Sachiko Oh-ishi, Hidekazu Yasui, Yoshiaki Azuma, Noriyasu Hirasawa, Kazuo Ohuchi, Hiroshi Kawaguchi, Yukio Ishikawa, Toshiharu Ishii, Satoshi Uematsu, Shizuo Akira, Makoto Murakami, and Ichiro Kudo. Reduced Pain Hypersensitivity and Inflammation in Mice Lacking Microsomal Prostaglandin E Synthase-1. J. Biol. Chem. Aug 2004;
279
(32)
:33684-33695
|
Makoto Murakami, Seiko Masuda, Kaori Ueda-Semmyo, Emiko Yoda, Hiroshi Kuwata, Yasukazu Takanezawa, Junken Aoki, Hiroyuki Arai, Hideki Sumimoto, Yukio Ishikawa, Toshiharu Ishii, Yoshihito Nakatani, and
Ichiro Kudo.
Group VIB Ca2+-independent phospholipase A2 γ promotes cellular membrane hydrolysis and prostaglandin production in a manner distinct from other intracellular phospholipases A2.
J. Biol. Chem. Apr 2005;
280
(14)
:14028-14041
|
Xiu Qin Xu, B. Starling Emerald, Eyleen L. L Goh, Nagarajan Kannan, Lance D. Miller, Peter D. Gluckman, Edison T. Liu, and Peter E. Lobie. Gene expression profiling to identify oncogenic determinants of autocrine human growth hormone (hGH) in human mammary carcinoma. J. Biol. Chem. Jun 2005;
280
(25)
:23987-24003
|
Hiroshi Kuwata, Takuya Nonaka, Makoto Murakami, and Ichiro Kudo. Search of factors that intermediate cytokine-induced group IIA phospholipase A2 expression through the cytosolic phospholipase A2- and 12/15-lipoxygenase-dependent pathway. J. Biol. Chem. May 2005;
280
(27)
:25830-25839
|
Atsuko Yoneda, Hinke A.B. Multhaupt, and John R. Couchman. The Rho kinases I and II regulate different aspects of myosin II activity.
J. Cell. Biol. Aug 2005;
170
(3)
:443-453
|
Jen-Liang Su, Ching-Yao Yang, Jin-Yuan Shih, Lin-Hung Wei, Chang-Yao Hsieh, Yung-Ming Jeng, Ming-Yang Wang, Pan-Chyr Yang, and Min-Liang Kuo.
Knockdown of Contactin-1 Expression Suppresses Invasion and Metastasis of Lung Adenocarcinoma. Cancer Res. Mar 2006;
66
(5)
:2553-2561
|
Zhang Y, Zhang B. D4-GDI, a Rho GTPase Regulator, Promotes Breast Cancer Cell Invasiveness. Cancer Res. Jun 2006;
66
(11)
:5592-5598
|
Kuwata H, Fujimoto C, Yoda E, Shimbara S, Nakatani Y, Hara S, Murakami M, Kudo I. A novel role of group VIB calcium-independent phospholipase A2 (iPLA2gamma ) in the inducible expression of group IIA secretory phospholipase A2 in rat fibroblastic cells.
J Biol Chem. May 2007;
282
(28)
:20124-20132
|
Michael J. MacDonald, Andrew D. Smith, III, Noaman M. Hasan, Grzegorz Sabat, and Leonard A. Fahien.
Feasibility of pathways for transfer of acyl groups from mitochondria to the cytosol to form short chain acyl-CoAs in the pancreatic beta cell. J. Biol. Chem. Aug 2007;
|
PRODUCTINFO:
20051023211532 (PDF)
|